ailani9 ailani9

06-06-2023
Biology

contestada

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Respuesta :

Otras preguntas

What was the most important element of african trade with europe?

What are three problems immigrants faced in American cities in the late 1800s?

What are the 3 parts of the large intestine?

What is the best possible means of avoiding bacterial contamination

how do you think the northwest ordinance affected native Americans?

The tendency for people to see what they expect to see is termed:

Write a real world situation that can be represented by the expression x - 12 subtraction

Find a solution to the following system of equations. –5x + 2y = 9 3x + 5y = 7 A. (0, 1) B. (–9, 7) C. (–1, 2) D. (1, 7)

Write an inequality for the graph. A. y≤ |x – 5| + 5 B. y≤ |x + 5| + 5 C. y≤ |x – 5| – 5 D. y≥ |x – 5| + 5

Which statements are true about fractions and ratios? Select all that apply. All ratios are fractions. Some ratios are not fractions. All fractions are ratios.

good job