cfields172 cfields172

09-01-2024
Mathematics

contestada

using pigeonhole principle find out that how many numbers must be selected from the set {2, 4, 6, 8, 10, 12, 14, 16, 18, 20} to guarantee that at least one pair adds up to 22.

Respuesta :

Otras preguntas

Which is the youngest rock in this strata? mudstone siltstone limestone sandstone conglomerate

One example which shows prince shotoku is/is not worthy from the History Alive textbook is

Mathematically, why am i so uneducated?

Transcribe the following Strand of DNA: GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Mr. Bloss made 36 out of 48 free throws while practicing for basketball. What percent of his free throws did he make?

I NEED THIS ANSWERED PLEASE ASAP !!! Which detail from The Way to Rainy Mountain supports the central idea that the Kiowa oral tradition keeps the culture alive

Help me to answer this.

four water bottles can hold 8 gallons of water how much water can ten big water bottles hold

When autotrophs produce more organic matter than they use in respiration tehre is anet increase in organic matter. That is called A. Anaerobic repiration. B. D

What is the solution to the system of equations shown below? y = -x-2 4y + 8 = x A. No solution B. (2,0) C. (0,2) D. Infinitely many solutions

good job