rainaj61843 rainaj61843
  • 10-01-2024
  • Mathematics
contestada

In the derivation of the quadratic formula by completing the square, the equation (x+b/2A)^2 = -4ac+b^2/ 4a^2created by forming a perfect square trinomial.
What is the result of applying the square root property of equality to this equation?

Respuesta :

Otras preguntas

Please help me I’ll give you brainless
Jesse is buying a new cell phone online. It costs 8,835.3 yen (Japanese money). The U.S. dollar is worth 88.353 yen. How much will Jesse's cell phone cost in
EQOD: How did the geography and climate of South Asia influence ancient Indus River Vally civilizations?
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
If someone told you that the will destroy you and everyone you love, how would respond??
What is the SURFACE AREA
what was the main cause of the near extinction of the black-footed ferret? A. Climate change B. Dwindling prairie dog populations C. Natural predators D. For h
where in the cell, are the ribosomes?​
The DSM says that a person must meet at least ___ of the seven criteria to be considered having antisocial personality disorder. A) 2 B) 3 C) 4 D) 7
3 real life objects that would be considered COMPOSITE FIGURES
good job