prosier47 prosier47

08-11-2018
Biology

contestada

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Respuesta :

taylorskyrme taylorskyrme

19-11-2018

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine

Answer Link

Otras preguntas

¿Cómo puedo saber cuál es el número primo más grande por el que puedo dividir 42 504?

share 4000 in a ratio 3:4:1

Q. Find the measure of QR

Sodium metal and water react to form sodium hydroxide and hydrogen gas. What mass of Na will react with excess water to produce 0.38 mol NaOH? 2Na(s) + 2H2O(l)

Herbicide-resistant soybeans, pest-resistant cotton, and vitamin-enriched rice are all results of A bioengineering В. organic farming C. the Green Revolution D.

What is correct use of "whom"

Solve for x please thanks

Helppp! , Use parallelogram ABCD. What are the values of x and y ?

Jamaya has a 1.2 m long piece of wood. She wants to cut it into 3 equal lengths. How long should each plece be in centimeters? Each piece cm

write two equivalent expression with these numbers 14,16,11

good job