ghunderman24 ghunderman24

09-01-2019
Chemistry

contestada

What is the complementary DNA strand for the following sequence:
ATGGCTTGCCAAGGTCCGGAAACTTTG

Respuesta :

alexandraderigg alexandraderigg

09-01-2019

TACCGAACGGTTCCAGGCCTTTCAAAG

Answer Link

Otras preguntas

What equation shows the line with m = 5 and y-intercept = −4 written in slope-intercept form?

in some from of government the head of state is called

the bacteria in a colony are unable to preform transduction. How would this hurt the bacterial colony’s chance of survival?

One out of nine high school students have their own car and drives them to school on daily basis. On a certain day, 1,080 students shows up for school. What is

There is another class of coloured people who make a business of keeping the troubles, the wrongs, and the hardships of the Negro race before the public. Havin

Use the matrix method to solve the system of equations 2 x + 4 y = 8 and 6 x + 3 y = -3. The resulting matrix is:

How many times does DNA replication occur in meiosis?

The "swish" design for Nike is a _[blank]_. trade character trade name brand name brand mark

describe the Muslim contributions and areas of science Geography,mathematics ,medicine, art,and literature

Who is Jesus? Explain.

good job