kyleadler0807 kyleadler0807

07-12-2019
Biology

contestada

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Respuesta :

Milliecartier Milliecartier

07-12-2019

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

Answer Link

Otras preguntas

State the reason why caste can not determine the election results in India

I need to check some chemistry questions. Help with any question is appreciated! :) Please include an explanation with your conclusion.

Doctors have determined that harold is anemic. describe this condition. what are the primary pieces of evidence from the cbc that point to this diagnosis?

Complete the following statement. Our solar system is part of the _________ galaxy. A. Vega B. Solar System C. Milky Way D. Spiral Way

Sally proposes the idea that one's sexual history prior to marriage may be linked to whether one ends up getting divorced. this best represents which step of th

Select the equation of the line in which the x-intercept is -5, and the y-intercept is 10. Y-10= 1/2x Y-2= -2(x+4) Y-4=2(x+3) Y+3=2(x-4)

You are a kite sailing across the ocean. The table gives your height at different times. A. How many feet do you move each second?B. What is your speed? Give th

Line segment EF is shown on the coordinate grid:

What type of angle is shown?

Which of the following is NOT true of the Compromise of 1877? A). Samuel Tilden won the 1876 presidential election after a recount. B). Rutherford Hayes was giv

good job