cristaltejada8
cristaltejada8 cristaltejada8
  • 06-05-2020
  • Health
contestada

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Respuesta :

iveracisneros98
iveracisneros98 iveracisneros98
  • 06-05-2020

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

Answer Link

Otras preguntas

Which phrase in the declaration expresses the colonists’ opposition to taxation without representation?
At 7pm last night the temperature was at 10 degrees. At 7 am the next morning, the temperature was -2 degrees. By how much did the temperature change from 7pm t
The hawaiian island-emperor seamount chain formed as a result of ________.
A(n)__________ is a group of words that includes both a subject and a verb. A).Adjective B).Adverb C).Clause D).Conjunction
9 more than the quotient of negative 36 and negative 4
CD intersects AB at point G.if AE=BE which equation must be true?
Why do companies use the current model of production (using cheap labour in other countries) for clothing. (why/what benefits are there for companies)
ANSWER ASAPInstructions:Drag each characteristic to the correct category. Identify the beliefs of Protestants and the beliefs of Catholics. *believed that faith
how can you evaluate |-5|
Complete this grammar review. fill in the blanks with the present tense of the appropriate verbs from the list.
good job