giovannicapivara13 giovannicapivara13

10-09-2020
Mathematics

contestada

8x:2+9=3x+13 What is the result of this equation? Plssss Qual é o resultado dessa equação? Pfv

Respuesta :

ashbypink ashbypink

10-09-2020

exact form : 4/13
decimal form : .0.307692

Answer Link

Otras preguntas

What is 5.1 x 10^-1 as an ordinary number?

Which statement best compares events in Egypt, Libya, and Tunisia during the Obama presidency

Il faut aller _____________ pour acheter un manteau de marque. au marché de puces à l’épicerie au centre commercial à la librairie

SOMEONEONE HELP ME OUT ...............

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The first-serve percentage of a tennis player in a match is normally distributed with a standard deviation of 4.3%. If a sample of 15 random matches of the play

this holds an organims hereditary information

which number is equivalent to 13vover2

The concern with getting daughters married into good families pervades Jane Austen's Pride and Prejudice and forms a large part of the social mannerisms that th

NEED HELP!!! Jamie was surveying students about their use of the new computer lab in a school. Which question in the survey is a STATISTICAL QUESTION? A.) How

good job