eliward293 eliward293

10-11-2020
Mathematics

contestada

What is the unit rate for 822.6 km in 18 h?

Enter your answer, as a decimal, in the box.

[]

Respuesta :

two797714 two797714

13-11-2020

The correct answer is 45.7

Ver imagen two797714

Answer Link

Otras preguntas

Is the following salt an acid, base, or neutral? NH4ClO4

three things every organism on earth need to survive

Ne of two major types of cells in the nervous system; this cell supports, nourishes, and protects the neurons and maintains the interstitial fluid that bathes n

first row has 15 seats and each row after will have 5 seats more in the row in front of it

Kevin has $100 in a savings account that earns 10% interest per year the interest is not compounded how much interest will he earn in one year

Lori has decided to let Jen, the newest member of the team, present at the next board meeting. Jen’s ready; she just needs confidence. What quality is Lori exhi

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The constitution was the first written plan of government for the united states true or false

How do the first few chapters foreshadow Victor's dark future?

What are two ways that the relationship between the united states and Russia changed after the collapse of the Soviet Union

good job