Seudónimo Seudónimo
  • 07-12-2016
  • Mathematics
contestada

Michael drinks 355 milliliters of orange juice and puts 6 centiliters of syrup on his pancakes for breakfast. How many milliliters of liquid did he consume?

Respuesta :

Samis10
Samis10 Samis10
  • 07-12-2016
He would consume 415 milliliters of liquid.

6 centiliters = 60 milliliters
355 + 60 = 415

Hope this help!! :)
Answer Link

Otras preguntas

I don’t understand this
Which four battles did the South win in 1862 and 1863?
Imagine your family agreed to give you some pocket money every day for a month! How do you want to get paid? Pick one from the following options and post your
AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of
how are you going to use the power of yet and growth mindset in 2021
NEED HELP ASAP DUE 11:30 PM Which did not happen during the English Civil War and Restoration? Question 47 options: The Puritans who supported Parliament agains
The temperature was 80 °F and then fell 20 °F. What is the new temperature?
Please answer this HELLLPPPP!!!!!
Which animal is a primary consumer in the Ethiopian Highlands?
pls someone plsss help meeeee
good job