turnercaleb596 turnercaleb596

09-11-2021
Geography

contestada

Brainly if right. Based on the path to independence taken by the people of Haiti, Cuba, and Puerto Rico, which group do you believe recovered from European colonization the best?

Respuesta :

dakotalopez37 dakotalopez37

10-11-2021

Answer:

The Haiti

Explanation:

It might be the Haiti because there sugar cane stocks continued to rise up after.

Answer Link

Otras preguntas

Assume that Aye is guilty of this crime. What can explain why he waited so long to do it? After all, by waiting 9 years, Aye would have given Tut time to have a

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

please help me with this

6. How many 4 digit odd numbers can be formed if no digit can be repeated?

Does the point (2,-1) lie on the line y=3-2x?

what number comes next in 18,30,48,72,96

If a coin flipped twenty five times and lands tails up seventeen times, the blank Probability that the coin lands up is 17/25

What is the perimeter? Help plz... And No links!! I repeat No links!!

Lütfeeen çok aciiil Doğru ve hızlı bir şekilde cevaplarmısınız Rica Etsem.

I'm not good at this stuff i need help quick pleaseeeeee

good job