boogerpicker23 boogerpicker23

08-12-2022
Mathematics

contestada

2. 3, 6, 12, 24, ...what are factors of 3 counting by 3s?

Respuesta :

Otras preguntas

which agricultural design was used in both Mayan and ancient egypt civilizations A:Ziggurats B:Pyramids C:Steale D:Obelisks

Simplify. Remember to write the powers as a positive number. a^−2*b^5

The can is 12 cm high and the diameter is 8 cm using the formula V = TT r 2 h work out how much coconut milk is in the can use 3 as a value for TT

HELP PLS how would i write this equation???? One number is 5more than another. The sum of twice the smaller number plus fourtimes the larger number,is 56. Wh

Which immediate effect did the French and Indian War have on North America?

how did martain lurther stand for truth, knowledge and unconditional love

how do you express a number in scientific notation? A write the number in units of Avogadro's number B write the number as a fraction in scientific equation C w

which law regulate car driver behavior

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

A compound is found to contain 13.65 % carbon and 86.35 % fluorine by mass. what is the empirical formula for this compound

good job