rosslayla rosslayla

10-03-2017
Mathematics

contestada

Which describes the difference between the graph of f(x) = x4 and g(x) = -
1
3
(x4)?

Respuesta :

10-03-2017

g(x) is horiontally stretched so its wider, and its fliped across the x-axis comapred to f(x)

Answer Link

peyton0108 peyton0108

17-10-2021

Answer:

B) The graph of g(x) is obtained by flipping f(x) over the x-axis and shrinking vertically by a factor of 3.

Step-by-step explanation:

.

Answer Link

Otras preguntas

How did the Enlightenment impact the formation of the United States

When compared to Eurkaryotic cells , prokaryotic cells are almost always

As you probably know, there is still a difference in wages for men vs. women in this country. Besides straight-up discrimination and bias (which has been lessen

Jim has a toolbox with a volume of 9,072 cubic inches. The height of the toolbox is 14 inches and the width of toolbox is 1 foot.

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

he said he could swim or can

1. If Jose says that 75% of his class of 28 students rides the bus every day, how many students ride the bus? a. 25 b. 15 C. 21 (d. 10

Write a report about available facilities in your area and encourage people to take part of the benefits

Some bat species have auditory systems that work best over a narrow range of frequencies. To account for this, the bats adjust the sound frequencies they emit s

express a decade as a percentage of a century

good job