liz510 liz510
  • 10-08-2017
  • Biology
contestada

The element nitrogen has the atomic number 7 and an atomic mass of 14. How many neutrons does an atom of nitrogen contain?

Respuesta :

ninosalvia1200 ninosalvia1200
  • 10-08-2017
you subtract the atomic number  from the atomic mass so 14-7=7
there are 7 neutrons
Answer Link
sydbid123 sydbid123
  • 10-08-2017
nitrogen has 7 neutrons
Answer Link

Otras preguntas

Which One Doesn't Belong? 6(4 + 3) 418 + 14) 3(8 + 6) 18 + 24
Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement
please help me on this!
AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of
Choose the BEST antonym for the words below. order, harmony anarchy notorious Quakers Sabbath​
What are two number that multiply to 36 and add up to 9
What would happen if the Sun’s gravity did not hold the Earth in an orbit?
Using the common​ denominator, what is an equivalent fraction for ​4/7 ?
What 3 countries are the Axis Powers?
which nitrogen bases are pyrimidines
good job