stephaniebloss stephaniebloss

09-08-2015
English

contestada

Sometimes a short paragraph will be needed as a transition to achieve coherence in a research paper.

Respuesta :

mdb1432 mdb1432

09-08-2015

Yes, this is true. Occasionally one of your main points will not lead directly into the next point. In cases such as those, transitions are key because the paper needs to seem cohesive and needs to have a good flow.

Answer Link

Otras preguntas

Which of the following pair of functions are inverses of each other?

Find the measure of KL.

1. Ricardo y Emilia / traer un pastel / su prima 2. los turistas / llegar a las ruinas / barco 3. (yo) / tener resfriado / el frío 4. mis amigas / ganar dine

3. Before turning, always search for:

Someone invests a constant stream of $450 per year at a continuously compounding interest rate of 5%. What is the present value of this continuous stream if it

which information should he include in the MLA in text citation ?

A symbiotic relationship where both of the co-existing species benefit from the interaction is called ________. commensalism parasitism mutualism communism

What is the angle of repose? a. the angle of bedding on hills where layers dip parallel to the slope b. the angle of fractures on hills where fractures dip pa

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

As you approach a railroad crossing without any signals flashing, be prepared to stop if you are following a ___________ or hazardous materials truck.

good job