a0motyolomake
a0motyolomake a0motyolomake
  • 07-12-2015
  • History
contestada

How far did Darius extend the Persian Empire?

Respuesta :

slickerrrrr slickerrrrr
  • 07-12-2015
2500 miles . very far
Answer Link

Otras preguntas

Read the following two sentences from President John F. Kennedy’s July 11, 1963, radio and television address. Then, rewrite the sentences using a coordinating
the term that is used to describe the permanently frozen subsoil in siberia is...???
Energy from hot magma is called a magnetic b. geothermal C)nuclear d hydroelectric Please select the best answer from the choices provided
Brainlyest Which is the most common complaint about rechargeable batteries? A) Rechargeable batteries are hard to find. B) Rechargeable batteries are too expens
Transcribe the following Strand of DNA: GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Why is it forbidden for the Church to interfere in the State (politics) and why does the State not interfere in the church?
What effect do shiny metals have on radiant energy?
why did women fight for equality
The population of the United States is approximately 320,000,000 people. Which is a reasonable estimate for the amount of food consumed by the population of the
what fraction of an iceberg is above the surface of the water?
good job