chair333 chair333
  • 06-02-2019
  • Mathematics
contestada

A convex polygon has 4 sides what is the sum of the measures of its interior angles

Respuesta :

sevenas62
sevenas62 sevenas62
  • 06-02-2019

Answer:

If a convex polygon has n sides, then its interior angle sum is given by the following equation: S = ( n −2) × 180°.

Step-by-step explanation:

Where S is the angle-sum, and n is the number of sides. (2n-4) x 90 where n is the number of sides.

Answer Link

Otras preguntas

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
What should the nurse do to prevent infection when finished using accessed central vascular access device
Determine how the following bonds are made using Lewis dots structures
966 ÷ 7 how to solve with common core math
Hiiii Im needing help on some English Tyger, tyger, burning bright In the forests of the night, What immortal hand or eye Could frame thy fearful symmetry? In
A rectangular page that is x inches wide and has an area of 240 square inches. The page contains a printable area of 160 square inches. It has 2 inch margins at
Precalculus help!] For what values of x is log0.8 (x+4) > log0.4 (x+4)
PLEASE HELP. I AM STRUGGLING. You buy 1 1/4 yards of fabric and an $8 clothing pattern. You total cost with a 6% sales tax added is $18.55. What is the cost per
What is the title of the Diagram ? Please help , will mark brainly
is it possible someone would have had a motive to kill the boy king
good job