tabithabartlett2601 tabithabartlett2601

09-02-2020
Mathematics

contestada

Write an equation that relates the angles in a triangle the measures of angles X and Y are the same X degrees the measure of angle C is twice the measure of angle Y

Respuesta :

surjithayer10 surjithayer10

09-02-2020

Answer:

Step-by-step explanation:

x+x+2x=180

4x=180

x=45

2x=45×2=90

angles are 45°,45°,90°

Answer Link

Otras preguntas

what is the best classification for a triangle with sides 4,5, and 2?

Rich measured the height of a desk to be 80.7 cm. The actual height of the desk is 80 cm. What is Rich's percent error in this calculation? Type your answer a

I don't understand this

What did Catherine the Great do to expand Russia? Please help

which of the following is the product of the rational expression shown below? 5/2x-1 x 6/x

What is the aesthetic impact of Sojourner Truth's repetition of the question "and ain't I a woman?" in her speech at the Woman's Rights Convention? Select all t

What was the result of the 54th Massachusetts infantry attack on fort Wagner

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

How can the structure of a speech be important? APEX

what are some of george washington unconstitutional acts

good job