10-08-2020
Mathematics

contestada

Write the equations after translating the graph of y = |x| one unit to the right

Respuesta :

SilverChain SilverChain

10-08-2020

Answer:

y = |x - 1|

Step-by-step explanation:

You should recognize that subtracting the x term should translate the graph to the right

Answer Link

Otras preguntas

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Percy plotted the points (5,6)

Would George W. Bush be elected again in 2012?______Where is it addressed in the Constitution? (Article and Section)

Why does sociology work to create generalization about social life, rather than hard-and-fast rules?

Q. During one particular sales day, 75% of the store's customers paid with credit cards. If there were 60 customers that day, how many used a credit card?

NEED HELP!!! Which two statements are true about direct characterization in a play? It is expressed through character's’ appearance. It is expressed through ch

Which of the following choices is not a cue for a contrast or antonym context clue? A)On the other hand B)In other words C)However D)Unlike

Scientists such as Heinrich Hertz, Philipp Lenard, Max Planck, and Albert Einstein made scientific contributions that ultimately demonstrated that light is elec

Which of he following compounds is always part of an aqueous solution

Which amendment protects Americans' right to "keep and bear arms"?

good job