sethcribley sethcribley
  • 08-11-2020
  • Mathematics
contestada

What is the slope of the line that connects the points (0,7) and (4,15)

Respuesta :

Space
Space Space
  • 08-11-2020

Answer:

[tex]m=2[/tex]

General Formulas and Concepts:

Pre-Alg

  • Order of Operations: BPEMDAS

Alg I

  • Slope Formula: [tex]m=\frac{y_2-y_1}{x_2-x_1}[/tex]

Step-by-step explanation:

Step 1: Define

Point (0, 7)

Point (4, 15)

Step 2: Find slope m

  1. Substitute:                    [tex]m=\frac{15-7}{4-0}[/tex]
  2. Subtract:                       [tex]m=\frac{8}{4}[/tex]
  3. Divide:                           [tex]m=2[/tex]
Answer Link

Otras preguntas

What signs of habitability would you look for on Mars?
Please help ASAP 25 points:)
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
In his pamphlet Common Sense, published in January, 1776, Thomas Paine used the everyday language of the colonists to express his feelings about Great Britain.
How have wars, emergencies, and the media contributed to the expansion of presidential powers?
Find the volume in cubic centimeters. 5832 cm3 18 cm3 5.832 cm3 0.18 cm3
In Langston Hughes’s poem “The negro speaks of rivers” what does the Mississippi River symbolize
Which amendment protects Americans' right to "keep and bear arms"?
What did the incas build that was 14000 miles that connected their empire
Write the answer in simplest form 5 3/8 x 2 1/2
good job