kierstinmorgan08 kierstinmorgan08

08-02-2022
Engineering

contestada

How can you exercise without hurting yourself.

Respuesta :

isaac7138 isaac7138

09-02-2022

Just doing simple runs or running on a treadmill or go on bikes

Answer Link

Otras preguntas

What impact did factories have on the lives of workers?

Okay! Hello Universe. This is your new doge, Peater. So my friend. Demon3000 was in there room all night playing a song on there guitar (mine.) and singing. I c

what does equals 8a+16

(1) Saad had a box that is 15cm by 20cm by 22cm. What is the volume of the box? (2) jake is redoing her kitchen. It measures 18ft by 19 ft. If wallpaper costs $

what component of a wet-dry vacuum cleaner is not present in a typical canister style residential cleaner

Ken keeps paper cups in a box is the shape of a cube side of a cube Each side is 3 inches what is the volume Of the. Cube

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication

Which sentence contains an infinitive? * Li says learning to speak French is easier than you think. * Marco went to the doctors for advice about his knee * If s

Describe Antarctica's qualities and explain why this unique continent would attract scientific study.

George is building a fence around a rectangular dog run. He is using his house as one side of the run. The area of the dog run will be 240 square feet. The leng

good job