pricilarose19 pricilarose19

11-08-2017
History

contestada

Describe how the alliances during world war 2 changed over time.

Respuesta :

angiehahnotv71e angiehahnotv71e

11-08-2017

We fought with Russia, but then after that we had a cold war with them.

Answer Link

Otras preguntas

geometry math question please help me :)

In which region would you expect to find the highest share of deaths due to unintentional injuries? Europe and Central Asia Sub-Saharan Africa Middle East and N

Why isn't it possible to divide a factor with 0? And if so, what is the answer? 0? ∞?

What type of energy is likely changed into thermal energy in this hand warmer? A. electromagnetic energy B. electrical energy C. chemical energy D. kinetic en

Which graph shows the solution to the given system? y = -5x – 2 y + 2 = -5x infinitely many solutions

Mr. Hardy built a fenced-in area for his children in the shape of a square with each side 75 feet in length. Find the distance of the diagonal path from one cor

Sheila wants to know how certain plants help manage nuisance insects, such as mosquitoes and flies, in outdoor spaces. Which research question would help Sheila

Given the function f(x) = 3x - 7, determine which of the following values will result in f(x) = -1.

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

People reject the government's monopoly on violence, and claim the right for themselves, in a(n) ___. a. state. b. exercise of traditional authority. c. el

good job